Expression of aryl hydrocarbon receptor mRNA in porcine retina

Purpose. The aryl hydrocarbon receptor (AHR) mediates CYP1A1/1A2 induction by aryl hydrocarbons (e.g. TCDD). AHR proteins are similar to steroid receptors in their mechanism of action but constitute a distinct molecular family (1). In addition to a role in drug metabolism, it was suggested that AHR may regulate the homeostasis and cell differentiation (2). Two Drosophila proteins Sim and Per which are homologous to AHR appear to play roles in neural development and circadian rhythm, respectively. AHR may also have a function in mammalian retina. In this study, therefore, we investigated whether AHR mRNA is expressed in porcine retina. Methods. cDNA was synthesized from porcine retina RNA by RT-PCR using primers designed from mouse AHR cDNA and cloned into pCR^TM II vector. DNA was sequenced with SP6 and T7 primers and analyzed by NCBI BLAST Search. Results. From a comparison of 341 bases, the porcine retina PCR product was found to be very similar to AHR from several species [rat (R), mouse (M), human (H), sheep (S)]. Hog: ACATAACGGACGAAATCCTGACCCGGTTGCAGAA R: -------A--------------GTACG-----G- (- , identical residue) M: -------G---------------TACG-----G-Hog: GTCATAGCTATTCTGTGTGAATGTATATACATTCACACAGAATAGCTATGAC H: ---------G------------------------------------------S: ------------------------------------------C---------Conclusions. AHR message is expressed in porcine retina. In the eye CYP1A1/1A2 induction is highest in the ciliary epithelium and negligible in the retina (3). Then, the question is: What is AHR doing in the retina?.